Быстрый заказ

Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rabbit CD38 Информация о продукте «Клон cDNA»
Размер кДНК:897bp
Описание кДНК:Full length Clone DNA of Rabbit CD38 molecule with N terminal Flag tag.
Синоним гена:CD38
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаTG65003-ACGRBS15400
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаTG65003-ACRRBS15400
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаTG65003-CFRBS13340
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаTG65003-CHRBS13340
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаTG65003-CMRBS13340
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаTG65003-CYRBS13340
Кролик CD38/ADPRC1 Джин клон кДНК в вектор клонированияTG65003-GRBS5130
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаTG65003-NFRBS13340
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаTG65003-NHRBS13340
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаTG65003-NMRBS13340
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаTG65003-NYRBS13340
Кролик CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмидыTG65003-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 38 (CD38), also known as ADP-ribosyl cyclase, is a glycoprotein found on the surface of many immune cells (white blood cells), including CD4+, CD8+, B and natural killer cells. It shares several characteristics with ADP-ribosyl cyclase 2 CD157. CD38 is a multifunctional ectoenzyme that catalyzes the synthesis and hydrolysis of cyclic ADP-ribose (cADPR) from NAD+ to ADP-ribose. It also functions in cell adhesion, signal transduction and calcium signaling. CD38 has been used as a prognostic marker in leukemia. It can also be used to identify plasma cells.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Size / Price
    Каталог: TG65003-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.