Быстрый заказ

Text Size:AAA

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRKAA1 Информация о продукте «Клон cDNA»
Размер кДНК:
Описание кДНК:
Синоним гена:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Human PRKAA1 Gene Plasmid Map
Human PRKAA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11488-ACGRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11488-ACRRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11488-ANGRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11488-ANRRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11488-CFRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11488-CHRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11488-CMRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11488-CYRBS14710
Человек PRKAA1 Gene cDNA clone plasmidHG11488-MRBS5130
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11488-NFRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11488-NHRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11488-NMRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11488-NYRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмидыHG11488-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Contact Us
  • Human PRKAA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.