Быстрый заказ

ПаспортОбзорыСвязанные продуктыПротоколы
Человек PRKAA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:
переносчик:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Shipping_carrier:
Склад:
Человек PRKAA1 Gene Plasmid Map
Human PRKAA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11488-ACGRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11488-ACRRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11488-ANGRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11488-ANRRBS16760
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11488-CFRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11488-CHRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11488-CMRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11488-CYRBS14710
Человек PRKAA1 Gene cDNA clone plasmidHG11488-MRBS5130
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11488-NFRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11488-NHRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11488-NMRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11488-NYRBS14710
Человек PRKAA1 Джин ORF экспрессии кДНК клона плазмидыHG11488-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».