Быстрый заказ

Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PIGP Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_153681.2
    Размер кДНК:477bp
    Описание кДНК:Full length Clone DNA of Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class P, transcript variant 1 with Flag tag.
    Синоним гена:DCRC, DSRC, DSCR5, DCRC-S
    Виды:Human
    переносчик:pCMV2-FLAG
    Plasmid:pCMV2-PIGP-flag
    Участок рестрикции:KpnI + XhoI (5.4kb + 0.53kb)
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PIGP qPCR primers for gene expression analysis, HP100303 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    pCMV2-FLAG Vector Information
     
    Vector Name pCMV2-FLAG
    Vector Size 5592bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive, Stable / Transient
    Promoter CMV
    Antibiotic Resistance Kanamycin
    Selection In Mammalian Cells Hygromycin
    Protein Tag FLAG
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)

    Schematic of pCMV2-FLAG Multiple Cloning Sites

    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10253-ACGRBS15400
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10253-ACRRBS15400
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10253-CFRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10253-CHRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10253-CMRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10253-CYRBS13340
    Человек PIGP transcript variant 1 Джин клон кДНК в вектор клонированияHG10253-MRBS5130
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10253-M-FRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10253-NFRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10253-NHRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10253-NMRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10253-NYRBS13340
    Человек PIGP transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10253-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10253-M-F
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».