Neuropeptide Y cDNA ORF Clone, Human, untagged

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Neuropeptide Y cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
294 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two point mutations: 150G/A and 204C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human neuropeptide Y DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Neuropeptide Y cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neuropeptide Y cDNA ORF Clone, Human, untagged: Alternative Names

PYY4 cDNA ORF Clone, Human

Neuropeptide Y Background Information

Neuropeptide Y (NPY) is a neuromodulator that is widely expressed throughout the central nervous system (CNS) and which is cosecreted with classic neurotransmitters including GABA and glutamate. Neuropeptide Y (NPY)/Agouti-related protein (AgRP) neurons in the arcuate nucleus of the hypothalamus are part of a neuroendocrine feedback loop that regulates feeding behavior and glucose homeostasis. NPY/AgRP neurons sense peripheral signals (including the hormones leptin, insulin, and ghrelin) and integrate those signals with inputs from other brain regions.Neuropeptide Y (NPY) plays different roles in mammals such as: regulate food intake, memory retention, cardiovascular functions, and anxiety.
Full Name
neuropeptide Y
Add to Cart Successfully Add to Cart Failed