Быстрый заказ

Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь ZSWIM3 Информация о продукте «Клон cDNA»
    Размер кДНК:2088bp
    Описание кДНК:Full length Clone DNA of Mus musculus zinc finger SWIM-type containing 3 with C terminal His tag.
    Синоним гена:C86566, 4921517A06Rik
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53036-ACGRBS16760
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53036-ACRRBS16760
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53036-ANGRBS16760
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53036-ANRRBS16760
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53036-CFRBS14710
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53036-CHRBS14710
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53036-CMRBS14710
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53036-CYRBS14710
    Мышь ZSWIM3 Джин клон кДНК в вектор клонированияMG53036-GRBS5130
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53036-NFRBS14710
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53036-NHRBS14710
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53036-NMRBS14710
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53036-NYRBS14710
    Мышь ZSWIM3 Джин ORF экспрессии кДНК клона плазмидыMG53036-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG53036-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.