After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ZGPAT Информация о продукте «Клон cDNA»
Размер кДНК:1536bp
Описание кДНК:Full length Clone DNA of Mus musculus zinc finger, CCCH-type with G patch domain with N terminal HA tag.
Синоним гена:BC021513, 1500006I01Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52022-ACGRBS16760
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52022-ACRRBS16760
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52022-ANGRBS16760
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52022-ANRRBS16760
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52022-CFRBS14710
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52022-CHRBS14710
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52022-CMRBS14710
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52022-CYRBS14710
Мышь ZGPAT Джин клон кДНК в вектор клонированияMG52022-GRBS5130
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52022-NFRBS14710
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52022-NHRBS14710
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52022-NMRBS14710
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52022-NYRBS14710
Мышь ZGPAT Джин ORF экспрессии кДНК клона плазмидыMG52022-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52022-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.