Быстрый заказ

Text Size:AAA

Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ZCCHC18 Информация о продукте «Клон cDNA»
Размер кДНК:1182bp
Описание кДНК:Full length Clone DNA of Mus musculus zinc finger, CCHC domain containing 18 with N terminal HA tag.
Синоним гена:Sizn2, 1500031H04Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52036-ACGRBS15400
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52036-ACRRBS15400
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52036-ANGRBS15400
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52036-ANRRBS15400
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52036-CFRBS13340
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52036-CHRBS13340
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52036-CMRBS13340
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52036-CYRBS13340
Мышь ZCCHC18 Джин клон кДНК в вектор клонированияMG52036-GRBS5130
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52036-NFRBS13340
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52036-NHRBS13340
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52036-NMRBS13340
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52036-NYRBS13340
Мышь ZCCHC18 Джин ORF экспрессии кДНК клона плазмидыMG52036-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52036-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.