ZCCHC17 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52592-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ZCCHC17 Reagents

CRO Services

Product recommended


All ZCCHC17 Reagents

ZCCHC17 cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
726 bp
Description
Full length Clone DNA of Mouse zinc finger, CCHC domain containing 17 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZCCHC17 cDNA ORF Clone, Mouse, C-His tag Alternative Names

2810055E05Rik cDNA ORF Clone, Mouse;HSPC251 cDNA ORF Clone, Mouse;LDC4 cDNA ORF Clone, Mouse;pNO40 cDNA ORF Clone, Mouse;pS1D cDNA ORF Clone, Mouse

ZCCHC17 Background Information

Full Name
zinc finger, CCHC domain containing 17

ZCCHC17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZCCHC17 cDNA ORF Clone in Cloning Vector, Mouse MG52592-G
ZCCHC17 cDNA ORF Clone, Mouse, untagged MG52592-UT
ZCCHC17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52592-ACG
ZCCHC17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52592-ACGLN
ZCCHC17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52592-ACR
ZCCHC17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52592-CF
ZCCHC17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52592-NF
ZCCHC17 cDNA ORF Clone, Mouse, N-His tag MG52592-NH
ZCCHC17 cDNA ORF Clone, Mouse, C-HA tag MG52592-CY
ZCCHC17 cDNA ORF Clone, Mouse, N-HA tag MG52592-NY
ZCCHC17 cDNA ORF Clone, Mouse, C-Myc tag MG52592-CM
ZCCHC17 cDNA ORF Clone, Mouse, N-Myc tag MG52592-NM
ZCCHC17 qPCR Primer Pairs, Mouse MP202463

ZCCHC17 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZCCHC17 cDNA ORF Clone in Cloning Vector, Human HG16966-U
ZCCHC17 cDNA ORF Clone, Human, untagged HG16966-UT
ZCCHC17 cDNA ORF Clone, Human, C-GFPSpark® tag HG16966-ACG
ZCCHC17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16966-ACGLN
ZCCHC17 cDNA ORF Clone, Human, N-GFPSpark® tag HG16966-ANG
ZCCHC17 cDNA ORF Clone, Human, C-OFPSpark® tag HG16966-ACR
ZCCHC17 cDNA ORF Clone, Human, N-OFPSpark® tag HG16966-ANR
ZCCHC17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16966-CF
ZCCHC17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16966-NF
ZCCHC17 cDNA ORF Clone, Human, C-His tag HG16966-CH
ZCCHC17 cDNA ORF Clone, Human, N-His tag HG16966-NH
ZCCHC17 cDNA ORF Clone, Human, C-HA tag HG16966-CY
ZCCHC17 cDNA ORF Clone, Human, N-HA tag HG16966-NY
ZCCHC17 cDNA ORF Clone, Human, C-Myc tag HG16966-CM
ZCCHC17 cDNA ORF Clone, Human, N-Myc tag HG16966-NM
info info
添加购物车成功! 添加购物车失败!