Ku70 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

Ku70 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1827 bp
Description
Full length Clone DNA of Mouse X-ray repair complementing defective repair in Chinese hamster cells 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Ku70 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

70kDa cDNA ORF Clone, Mouse; G22p1 cDNA ORF Clone, Mouse; Ku70 cDNA ORF Clone, Mouse

Ku70 Background Information

XRCC6 (X-ray repair complementing defective repair in Chinese hamster cells 6) is involved in tumor growth in several tumor types.XRCC6 exerts tumor-promoting effects for OS through β-catenin/Wnt signaling pathway. In addition, XRCC6 and XRCC7 are two DNA repair genes forme an integral part of double strand break repair (DSBR) pathway.
Full Name
X-ray repair complementing defective repair in Chinese hamster cells 6
Add to Cart Successfully Add to Cart Failed