Быстрый заказ

Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь WTAP Информация о продукте «Клон cDNA»
    Размер кДНК:456bp
    Описание кДНК:Full length Clone DNA of Mus musculus Wilms tumour 1-associating protein with C terminal Flag tag.
    Синоним гена:2810408K05Rik, 9430038B09Rik
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with WTAP qPCR primers for gene expression analysis, MP202071 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52198-ACGRBS15400
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52198-ACRRBS15400
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52198-ANGRBS15400
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52198-ANRRBS15400
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52198-CFRBS13340
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52198-CHRBS13340
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52198-CMRBS13340
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52198-CYRBS13340
    Мышь WTAP Джин клон кДНК в вектор клонированияMG52198-GRBS5130
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52198-NFRBS13340
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52198-NHRBS13340
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52198-NMRBS13340
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52198-NYRBS13340
    Мышь WTAP Джин ORF экспрессии кДНК клона плазмидыMG52198-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.