Быстрый заказ

Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь WARS2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027462.4
Размер кДНК:1083 bp
Описание кДНК:Full length Clone DNA of Mus musculus tryptophanyl tRNA synthetase 2 (mitochondrial)
Синоним гена:5730427B17Rik,9430020O07Rik,AI413375,TrpRS
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53037-ACGRBS15400
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53037-ACRRBS15400
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53037-ANGRBS15400
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53037-ANRRBS15400
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53037-CFRBS13340
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53037-CHRBS13340
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53037-CMRBS13340
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53037-CYRBS13340
Mouse WARS2 Gene cDNA clone plasmidMG53037-GRBS5130
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53037-NFRBS13340
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53037-NHRBS13340
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53037-NMRBS13340
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53037-NYRBS13340
Мышь WARS2 Джин клон кДНК в вектор клонированияMG53037-URBS5130
Мышь WARS2 Джин ORF экспрессии кДНК клона плазмидыMG53037-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG53037-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».