Быстрый заказ

Мышь VGF Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

  • Mouse VGF natural ORF mammalian expression plasmid, C-His tag
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь VGF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001039385.1
Размер кДНК:1854bp
Описание кДНК:Full length Clone DNA of Mus musculus VGF nerve growth factor inducible with C terminal His tag.
Синоним гена:Gm1052
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:pCMV3-mVGF-His
Участок рестрикции:KpnI + XbaI (6kb + 1.90kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with VGF qPCR primers for gene expression analysis, MP201590 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь VGF Gene Plasmid Map
Mouse VGF natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь VGF Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».