After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse USP5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK154008.1
Размер кДНК:2508bp
Описание кДНК:Full length Clone DNA of Mus musculus ubiquitin specific peptidase 5 (isopeptidase T).
Синоним гена:ISOT, Ucht, ISOT-1, AA407472
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51371-ACGRBS22240
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51371-ACRRBS22240
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51371-ANGRBS22240
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51371-ANRRBS22240
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51371-CFRBS20190
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51371-CHRBS20190
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51371-CMRBS20190
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51371-CYRBS20190
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51371-NFRBS20190
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51371-NHRBS20190
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51371-NMRBS20190
Мышь USP5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51371-NYRBS20190
Мышь USP5 Джин клон кДНК в вектор клонированияMG51371-URBS5130
Мышь USP5 Джин ORF экспрессии кДНК клона плазмидыMG51371-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ubiquitin carboxyl-terminal hydrolase 5, also known as Deubiquitinating enzyme 5, Isopeptidase T, Ubiquitin thiolesterase 5, Ubiquitin-specific-processing protease 5, ISOT and USP5, is a member of the peptidase C19 family. USP5 contains 2 UBA domains and one UBP-type zinc finger. The UBP-type zinc finger domain interacts selectively with an unmodified C-terminus of the proximal ubiquitin. Both UBA domains are involved in polyubiquitin recognition. The UBP-type zinc finger domain crystallizes as a dimer linked by a disulfide bond between the Cys-195 residues of both molecules, but there is no evidence that the full-length USP5 exists as a dimer. USP5 cleaves linear and branched multiubiquitin polymers with a marked preference for branched polymers. USP5 is involved in unanchored 'Lys-48'-linked polyubiquitin disassembly. It binds linear and 'Lys-63'-linked polyubiquitin with a lower affinity. Knock-down of USP5 causes the accumulation of p53/TP53 and an increase in p53/TP53 transcriptional activity because the unanchored polyubiquitin that accumulates is able to compete with ubiquitinated p53/TP53 but not with MDM2 for proteasomal recognition.

Ссылки
  • Reyes-Turcu F.E., et al., 2006, Cell 124:1197-1208.
  • Reyes-Turcu F.E., et al., 2008, J. Biol. Chem. 283:19581-19592.
  • Dayal S., et al., 2009, J. Biol. Chem. 284:5030-5041.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Каталог: MG51371-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».