After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь UNK Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse UNK Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK134361.1
Размер кДНК:2394bp
Описание кДНК:Full length Clone DNA of Mus musculus unkempt homolog (Drosophila).
Синоним гена:Zc3h5, Zc3hdc5, mKIAA1753, B230379M23Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51370-ACGRBS16760
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51370-ACRRBS16760
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51370-ANGRBS16760
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51370-ANRRBS16760
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51370-CFRBS14710
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51370-CHRBS14710
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51370-CMRBS14710
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51370-CYRBS14710
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51370-NFRBS14710
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51370-NHRBS14710
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51370-NMRBS14710
Мышь UNK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51370-NYRBS14710
Мышь UNK Джин клон кДНК в вектор клонированияMG51370-URBS5130
Мышь UNK Джин ORF экспрессии кДНК клона плазмидыMG51370-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51370-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».