Быстрый заказ

Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь UNC50 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_006496222.1
    Размер кДНК:780bp
    Описание кДНК:Full length Clone DNA of Mus musculus unc-50 homolog (C. elegans) with N terminal Flag tag.
    Синоним гена:URP, GMH1, UNCL, 1110002A21Rik
    Виды:Mouse
    переносчик:pCMV3-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52946-ACGRBS15400
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52946-ACRRBS15400
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52946-ANGRBS15400
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52946-ANRRBS15400
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52946-CFRBS13340
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52946-CHRBS13340
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52946-CMRBS13340
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52946-CYRBS13340
    Мышь UNC50 Джин клон кДНК в вектор клонированияMG52946-GRBS5130
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52946-NFRBS13340
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52946-NHRBS13340
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52946-NMRBS13340
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52946-NYRBS13340
    Мышь UNC50 Джин ORF экспрессии кДНК клона плазмидыMG52946-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».