Быстрый заказ

Text Size:AAA

Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse UFSP2 Информация о продукте «Клон cDNA»
Размер кДНК:1386bp
Описание кДНК:Full length Clone DNA of Mus musculus UFM1-specific peptidase 2 with N terminal HA tag.
Синоним гена:1810047C23Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52031-ACGRBS15400
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52031-ACRRBS15400
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52031-ANGRBS15400
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52031-ANRRBS15400
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52031-CFRBS13340
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52031-CHRBS13340
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52031-CMRBS13340
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52031-CYRBS13340
Мышь UFSP2 Джин клон кДНК в вектор клонированияMG52031-GRBS5130
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52031-NFRBS13340
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52031-NHRBS13340
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52031-NMRBS13340
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52031-NYRBS13340
Мышь UFSP2 Джин ORF экспрессии кДНК клона плазмидыMG52031-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52031-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.