After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь UBB Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse UBB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_006533159.1
Размер кДНК:918bp
Описание кДНК:Full length Clone DNA of Mus musculus ubiquitin B.
Синоним гена:Ubc; Ubb2; Uba52; Rps27a; AL033289
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51353-ACGRBS15400
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51353-ACRRBS15400
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51353-ANGRBS15400
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51353-ANRRBS15400
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51353-CFRBS13340
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51353-CHRBS13340
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51353-CMRBS13340
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51353-CYRBS13340
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51353-NFRBS13340
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51353-NHRBS13340
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51353-NMRBS13340
Мышь UBB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51353-NYRBS13340
Мышь UBB Джин клон кДНК в вектор клонированияMG51353-URBS5130
Мышь UBB Джин ORF экспрессии кДНК клона плазмидыMG51353-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51353-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».