Быстрый заказ

Text Size:AAA

Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NTRK2 Информация о продукте «Клон cDNA»
Размер кДНК:2466bp
Описание кДНК:Full length Clone DNA of Mus musculus neurotrophic tyrosine kinase, receptor, type 2, transcript variant 1 with N terminal His tag.
Синоним гена:Tkrb, trkB, AI848316, C030027L06Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50132-ACGRBS16760
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50132-ACRRBS16760
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50132-CFRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50132-CHRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50132-CMRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50132-CYRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин клон кДНК в вектор клонированияMG50132-MRBS5130
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50132-NFRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50132-NHRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50132-NMRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50132-NYRBS14710
Мышь TrkB/NTRK2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыMG50132-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Size / Price
    Каталог: MG50132-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.