Быстрый заказ

Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь TUBG2 Информация о продукте «Клон cDNA»
    Размер кДНК:1356bp
    Описание кДНК:Full length Clone DNA of Mus musculus tubulin, gamma 2 with N terminal HA tag.
    Синоним гена:Tubgl, AI504772
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with TUBG2 qPCR primers for gene expression analysis, MP201882 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52009-ACGRBS15400
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52009-ACRRBS15400
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52009-ANGRBS15400
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52009-ANRRBS15400
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52009-CFRBS13340
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52009-CHRBS13340
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52009-CMRBS13340
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52009-CYRBS13340
    Мышь TUBG2 Джин клон кДНК в вектор клонированияMG52009-GRBS5130
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52009-NFRBS13340
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52009-NHRBS13340
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52009-NMRBS13340
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52009-NYRBS13340
    Мышь TUBG2 Джин ORF экспрессии кДНК клона плазмидыMG52009-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.