beta-III Tubulin / TUBB3 cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

beta-III Tubulin / TUBB3 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1353 bp
Description
Full length Clone DNA of Mouse tubulin, beta 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta-III Tubulin / TUBB3 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

3200002H15Rik cDNA ORF Clone, Mouse; M(beta)3 cDNA ORF Clone, Mouse; M(beta)6 cDNA ORF Clone, Mouse

beta-III Tubulin / TUBB3 Background Information

The overexpression of TUBB3 could be related to reduced efficiency of taxane-based targeting anticancer drugs in several cancer types. TUBB3 serves as an independent prognostic marker and may be a valuable biomarker for routine application in esophageal adenocarcinoma especially to address the need for adjuvant treatment in individuals following neoadjuvant therapy and surgery. TUBB3 is of clinical relevance as overexpression has been linked to poor response to microtubule-targeting anti-cancer drugs such as taxanes. Mutations in TUBB3 have been associated with complex cortical dysplasia and other brain malformations and congenital fibrosis of extraocular muscles type 3A (CFEOM3A). The direct silencing of TUBB3 reverses induced multiple cross-resistance, reduces drug-resistant tumor mass, and suppresses the impaired microtubule stability status of PTX-resistant cells with transient cross-resistance.
Full Name
tubulin, beta 3 class III
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait