Быстрый заказ

Text Size:AAA

Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TUBB3 Информация о продукте «Клон cDNA»
Размер кДНК:1353bp
Описание кДНК:Full length Clone DNA of Mus musculus tubulin, beta 3 with C terminal His tag.
Синоним гена:M(beta)3, M(beta)6, 3200002H15Rik, Tubb3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51063-ACGRBS15400
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51063-ACRRBS15400
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51063-ANGRBS15400
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51063-ANRRBS15400
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51063-CFRBS13340
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51063-CHRBS13340
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51063-CMRBS13340
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51063-CYRBS13340
Мышь TUBB3 / beta III Tubulin Джин клон кДНК в вектор клонированияMG51063-GRBS5130
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51063-NFRBS13340
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51063-NHRBS13340
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51063-NMRBS13340
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51063-NYRBS13340
Мышь TUBB3 / beta III Tubulin Джин ORF экспрессии кДНК клона плазмидыMG51063-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51063-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.