After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TUBB2A Информация о продукте «Клон cDNA»
Размер кДНК:1338bp
Описание кДНК:Full length Clone DNA of Mus musculus tubulin, beta 2A class IIA with C terminal HA tag.
Синоним гена:Tubb2, M(beta)2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51190-ACGRBS15400
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51190-ACRRBS15400
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51190-ANGRBS15400
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51190-ANRRBS15400
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51190-CFRBS13340
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51190-CHRBS13340
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51190-CMRBS13340
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51190-CYRBS13340
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51190-NFRBS13340
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51190-NHRBS13340
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51190-NMRBS13340
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51190-NYRBS13340
Мышь TUBB2A Джин клон кДНК в вектор клонированияMG51190-URBS5130
Мышь TUBB2A Джин ORF экспрессии кДНК клона плазмидыMG51190-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51190-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.