Быстрый заказ

Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TTLL12 Информация о продукте «Клон cDNA»
Размер кДНК:1920bp
Описание кДНК:Full length Clone DNA of Mus musculus tubulin tyrosine ligase-like family, member 12 with N terminal His tag.
Синоним гена:BC055368, D430005B17
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52814-ACGRBS16760
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52814-ACRRBS16760
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52814-ANGRBS16760
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52814-ANRRBS16760
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52814-CFRBS14710
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52814-CHRBS14710
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52814-CMRBS14710
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52814-CYRBS14710
Мышь TTLL12 Джин клон кДНК в вектор клонированияMG52814-GRBS5130
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52814-NFRBS14710
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52814-NHRBS14710
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52814-NMRBS14710
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52814-NYRBS14710
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмидыMG52814-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52814-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.