Быстрый заказ

Text Size:AAA

Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TTLL12 Информация о продукте «Клон cDNA»
Размер кДНК:1920bp
Описание кДНК:Full length Clone DNA of Mus musculus tubulin tyrosine ligase-like family, member 12 with N terminal HA tag.
Синоним гена:BC055368, D430005B17
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52814-ACGRBS16764
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52814-ACRRBS16764
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52814-ANGRBS16764
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52814-ANRRBS16764
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52814-CFRBS14711
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52814-CHRBS14711
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52814-CMRBS14711
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52814-CYRBS14711
Мышь TTLL12 Джин клон кДНК в вектор клонированияMG52814-GRBS5132
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52814-NFRBS14711
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52814-NHRBS14711
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52814-NMRBS14711
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52814-NYRBS14711
Мышь TTLL12 Джин ORF экспрессии кДНК клона плазмидыMG52814-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52814-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.