After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TSC22D1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009366.3
Размер кДНК:432bp
Описание кДНК:Full length Clone DNA of Mus musculus TSC22 domain family, member 1 with C terminal HA tag.
Синоним гена:Tsc, Egr5, Tsc22, TSC-22, Tgfb1i4, AA589566, AW105905
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51196-ACGRBS15400
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51196-ACRRBS15400
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51196-ANGRBS15400
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51196-ANRRBS15400
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51196-CFRBS13340
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51196-CHRBS13340
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51196-CMRBS13340
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51196-CYRBS13340
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51196-NFRBS13340
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51196-NHRBS13340
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51196-NMRBS13340
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51196-NYRBS13340
Мышь TSC22D1 Джин клон кДНК в вектор клонированияMG51196-URBS5130
Мышь TSC22D1 Джин ORF экспрессии кДНК клона плазмидыMG51196-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.

Ссылки
  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • Size / Price
    Каталог: MG51196-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».