Быстрый заказ

Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TRMT10C Информация о продукте «Клон cDNA»
Размер кДНК:1245bp
Описание кДНК:Full length Clone DNA of Mus musculus tRNA methyltransferase 10C with C terminal His tag.
Синоним гена:Rnmtd1, Rg9mtd1, D16Ertd454e, 1300018J16Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51710-ACGRBS15396
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51710-ACRRBS15396
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51710-ANGRBS15396
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51710-ANRRBS15396
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51710-CFRBS13343
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51710-CHRBS13343
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51710-CMRBS13343
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51710-CYRBS13343
Мышь TRMT10C Джин клон кДНК в вектор клонированияMG51710-GRBS5132
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51710-NFRBS13343
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51710-NHRBS13343
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51710-NMRBS13343
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51710-NYRBS13343
Мышь TRMT10C Джин ORF экспрессии кДНК клона плазмидыMG51710-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51710-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.