TRAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

TRAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2121 bp
Description
Full length Clone DNA of Mouse TNF receptor-associated protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TRAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

2410002K23Rik cDNA ORF Clone, Mouse; HSP75 cDNA ORF Clone, Mouse

TRAP1 Background Information

The Hsp9 molecular chaperones are ATP-dependent enzymes that maintain protein homeostasis and regulate many essential cellular processes. The mitochondrial Hsp9, TNF receptor-associated protein 1 (TRAP1), supports the folding and activity of electron transport components and is increasingly appreciated as a critical player in mitochondrial signaling. Tumor Necrosis Factor Receptor-Associated Protein 1 (TRAP1) is a molecular chaperone involved in the regulation of energetic metabolism in cancer cells. This protein is highly expressed in several cancers, such as glioblastoma, colon, breast, prostate and lung cancers and is often associated with drug resistance. However, TRAP1 is also downregulated in specific tumors, such as ovarian, bladder and renal cancers, where its lower expression is correlated with the worst prognoses and chemoresistance. TRAP1 is the only mitochondrial member of the Heat Shock Protein 9 (HSP9) family that directly interacts with respiratory complexes, contributing to their stability and activity. TRAP1 could be a promising therapeutic target for glutamine-addicted cancer.
Full Name
TNF receptor-associated protein 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait