After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TRAM1L1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_146140.3
Размер кДНК:1092bp
Описание кДНК:Full length Clone DNA of Mus musculus translocation associated membrane protein 1-like 1 with C terminal His tag.
Синоним гена:A830091N21Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52295-ACGRBS15400
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52295-ACRRBS15400
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52295-CFRBS13340
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52295-CHRBS13340
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52295-CMRBS13340
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52295-CYRBS13340
Мышь TRAM1L1 Джин клон кДНК в вектор клонированияMG52295-GRBS5130
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52295-NFRBS13340
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52295-NHRBS13340
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52295-NMRBS13340
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52295-NYRBS13340
Мышь TRAM1L1 Джин ORF экспрессии кДНК клона плазмидыMG52295-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52295-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».