Быстрый заказ

Text Size:AAA

Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TRA2B Информация о продукте «Клон cDNA»
Размер кДНК:867bp
Описание кДНК:Full length Clone DNA of Mus musculus transformer 2 beta homolog (Drosophila) with N terminal HA tag.
Синоним гена:SIG-41; Sfrs10; Silg41; TRA2beta; D16Ertd266e; 5730405G21Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51994-ACGRBS15396
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51994-ACRRBS15396
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51994-ANGRBS15396
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51994-ANRRBS15396
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51994-CFRBS13343
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51994-CHRBS13343
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51994-CMRBS13343
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51994-CYRBS13343
Mouse TRA2B Gene cDNA clone plasmidMG51994-GRBS5130
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51994-NFRBS13343
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51994-NHRBS13343
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51994-NMRBS13343
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51994-NYRBS13343
Мышь TRA2B Джин клон кДНК в вектор клонированияMG51994-URBS5132
Мышь TRA2B Джин ORF экспрессии кДНК клона плазмидыMG51994-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51994-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.