After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TPT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008125.3
Размер кДНК:519 bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor protein, translationally-controlled 1
Синоним гена:p21,p23,TCTP,Trt
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51648-ACGRBS15400
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51648-ACRRBS15400
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51648-ANGRBS15400
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51648-ANRRBS15400
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51648-CFRBS5130
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51648-CHRBS13340
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51648-CMRBS13340
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51648-CYRBS13340
Mouse TPT1 Gene cDNA clone plasmidMG51648-GRBS5130
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51648-NFRBS13340
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51648-NHRBS13340
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51648-NMRBS13340
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51648-NYRBS13340
Мышь TCTP /TPT1 Джин клон кДНК в вектор клонированияMG51648-URBS5130
Мышь TCTP /TPT1 Джин ORF экспрессии кДНК клона плазмидыMG51648-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tumor protein, also known as TPT1, is a highly conserved protein among many eukaryotic organisms. Tumor protein is involved in a variety of cellular activities, including microtubule stabilization, calcium-binding activities, and apoptosis. The Mammalian translationally controlled tumour protein (TPT1) (or P23) is a protein which has been found to be preferentially synthesised in cells during the early growth phase of some types of tumour, but which is also expressed in normal cells. It was first identified as a histamine-releasing factor, acting in IgE +-dependent allergic reactions. In addition, TPT1 has been shown to bind to tubulin in the cytoskeleton, has a high affinity for calcium, is the binding target for the antimalarial compound artemisinin, and is induced in vitamin D-dependent apoptosis. TPT1 production is thought to be controlled at the translational as well as the transcriptional level.

Ссылки
  • Thaw P. et al., 2001, Nat Struct Biol. 8 (8): 701-4.
  • Thiele H. et al., 2000, Eur J Biochem. 267 (17): 5473-81.
  • Chitpatima ST. et al., 1988, Nucleic Acids Res. 16 (5): 2350.
  • Size / Price
    Каталог: MG51648-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».