After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TPSAB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031187.3
Размер кДНК:933bp
Описание кДНК:Full length Clone DNA of Mus musculus tryptase alpha/beta 1 with C terminal HA tag.
Синоним гена:Mcp7, Mcp-7, Mcpt7, MMCP-7
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50497-ACGRBS15400
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50497-ACRRBS15400
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50497-ANGRBS15400
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50497-ANRRBS15400
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50497-CFRBS13340
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50497-CHRBS13340
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50497-CMRBS13340
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50497-CYRBS13340
Мышь TPSAB1 Джин клон кДНК в вектор клонированияMG50497-MRBS5130
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50497-NFRBS13340
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50497-NHRBS13340
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50497-NMRBS13340
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50497-NYRBS13340
Мышь TPSAB1 Джин ORF экспрессии кДНК клона плазмидыMG50497-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».