Быстрый заказ

Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TPP1 Информация о продукте «Клон cDNA»
Размер кДНК:1689bp
Описание кДНК:Full length Clone DNA of Mus musculus tripeptidyl peptidase I with N terminal Myc tag.
Синоним гена:Cln2; TPP-I
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52010-ACGRBS16760
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52010-ACRRBS16760
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52010-ANGRBS16760
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52010-ANRRBS16760
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52010-CFRBS14710
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52010-CHRBS14710
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52010-CMRBS14710
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52010-CYRBS14710
Mouse TPP1 Gene cDNA clone plasmidMG52010-GRBS4380
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52010-NFRBS14710
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52010-NHRBS14710
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52010-NMRBS14710
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52010-NYRBS14710
Мышь CLN2 Джин клон кДНК в вектор клонированияMG52010-URBS5130
Мышь CLN2 Джин ORF экспрессии кДНК клона плазмидыMG52010-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tripeptidyl-peptidase 1 (TPP1 / CLN2) is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. TPP1 / CLN2 May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Defects in TPP1 / CLN2 are the cause of neuronal ceroid lipofuscinosis type 2 (CLN2), a form of neuronal ceroid lipofuscinosis which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy.

  • Xin H, et al. (2007) TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 445(7127): 559-62.
  • O'Connor MS, et al. (2006) A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci U S A. 103(32): 11874-9.
  • Abreu E, et al. (2010) TIN2-tethered TPP1 recruits human telomerase to telomeres in vivo. Mol Cell Biol. 30(12): 2971-82.
  • Size / Price
    Каталог: MG52010-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.