Быстрый заказ

Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MPL Информация о продукте «Клон cDNA»
Размер кДНК:1881bp
Описание кДНК:Full length Clone DNA of Mus musculus myeloproliferative leukemia virus oncogene with C terminal Myc tag.
Синоним гена:CD110, TPO-R, c-mpl, hlb219, c-mpl-I, c-mpl-II, Mpl
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50373-ACGRBS16760
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50373-ACRRBS16760
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50373-CFRBS14710
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50373-CHRBS14710
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50373-CMRBS14710
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50373-CYRBS14710
Мышь c-MPL / CD110 / TPOR Джин клон кДНК в вектор клонированияMG50373-MRBS5130
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50373-NFRBS14710
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50373-NHRBS14710
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50373-NMRBS14710
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50373-NYRBS14710
Мышь c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмидыMG50373-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
Каталог: MG50373-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.