After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TOMM34 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025996.4
Размер кДНК:930bp
Описание кДНК:Full length Clone DNA of Mus musculus translocase of outer mitochondrial membrane 34.
Синоним гена:TOM34, Tomm34a, Tomm34b, 2610100K07Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51339-ACGRBS15400
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51339-ACRRBS15400
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51339-ANGRBS15400
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51339-ANRRBS15400
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51339-CFRBS13340
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51339-CHRBS13340
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51339-CMRBS13340
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51339-CYRBS13340
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51339-NFRBS13340
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51339-NHRBS13340
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51339-NMRBS13340
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51339-NYRBS13340
Мышь TOMM34 Джин клон кДНК в вектор клонированияMG51339-URBS5130
Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмидыMG51339-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51339-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».