Быстрый заказ

Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь TOMM34 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_025996.4
    Размер кДНК:930bp
    Описание кДНК:Full length Clone DNA of Mus musculus translocase of outer mitochondrial membrane 34.
    Синоним гена:TOM34, Tomm34a, Tomm34b, 2610100K07Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TOMM34 qPCR primers for gene expression analysis, MP201216 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51339-ACGRBS15400
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51339-ACRRBS15400
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51339-ANGRBS15400
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51339-ANRRBS15400
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51339-CFRBS13340
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51339-CHRBS13340
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51339-CMRBS13340
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51339-CYRBS13340
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51339-NFRBS13340
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51339-NHRBS13340
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51339-NMRBS13340
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51339-NYRBS13340
    Мышь TOMM34 Джин клон кДНК в вектор клонированияMG51339-URBS5130
    Мышь TOMM34 Джин ORF экспрессии кДНК клона плазмидыMG51339-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».