Быстрый заказ

Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TNFSF11 Информация о продукте «Клон cDNA»
Размер кДНК:951bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 11 with C terminal Myc tag.
Синоним гена:ODF, OPG, OPGL, RANKL, Ly109l, Trance
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50343-ACGRBS15400
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50343-ACRRBS15400
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50343-CFRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50343-CHRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50343-CMRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50343-CYRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин клон кДНК в вектор клонированияMG50343-MRBS5130
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50343-NFRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50343-NHRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50343-NMRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50343-NYRBS13340
Мышь RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмидыMG50343-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor ligand superfamily member 11, also known as Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a single-pass type II membrane protein which belongs to the tumor necrosis factor family. The receptor activator of nuclear factor-kappaB ligand (RANKL), its cognate receptor RANK, and its natural decoy receptor osteoprotegerin have been identified as the final effector molecules of osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communications, and lymph node formation. Moreover, RANKL and RANK are expressed in mammary gland epithelial cells and control the development of a lactating mammary gland during pregnancy. Genetically, RANKL and RANK are essential for the development and activation of osteoclasts and bone loss in response to virtually all triggers tested. Inhibition of RANKL function via the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastases. Importantly, RANKL appears to be the pathogenetic principle that causes bone and cartilage destruction in arthritis. RANK-RANKL signaling not only activates a variety of downstream signaling pathways required for osteoclast development, but crosstalk with other signaling pathways also fine-tunes bone homeostasis both in normal physiology and disease. In addition, RANKL and RANK have essential roles in lymph node formation, establishment of the thymic microenvironment, and development of a lactating mammary gland during pregnancy.

  • Takayanagi H, et al. (2002) Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4 Suppl 3: S227-32.
  • Nakashima T, et al. (2003) RANKL and RANK as novel therapeutic targets for arthritis. Curr Opin Rheumatol. 15(3): 280-7.
  • Schwarz EM, et al. (2007) Clinical development of anti-RANKL therapy. Arthritis Res Ther. 9 Suppl 1: S7.
  • Leibbrandt A, et al. (2008) RANK/RANKL: regulators of immune responses and bone physiology. Ann N Y Acad Sci. 1143: 123-50.
  • Size / Price
    Каталог: MG50343-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.