Быстрый заказ

Text Size:AAA

Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TNFRSF1B Информация о продукте «Клон cDNA»
Размер кДНК:1425bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 1b with N terminal His tag.
Синоним гена:p75, TNFBR, Tnfr2, CD120b, TNF-R2, TNFR80, TNFRII, Tnfr-1, TNF-R75, TNF-R-II, TNF-alphaR2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50128-ACGRBS15400
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50128-ACRRBS15400
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50128-CFRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50128-CHRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50128-CMRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50128-CYRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин клон кДНК в вектор клонированияMG50128-MRBS5130
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50128-NFRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50128-NHRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50128-NMRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50128-NYRBS13340
Мышь TNFR2/TNFRSF1B/CD120b Джин ORF экспрессии кДНК клона плазмидыMG50128-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), also known as Tumor necrosis factor receptor 2 (TNFR2) or CD120b antigen, is a member of the tumor necrosis factor receptor superfamily. TNFR2/CD120b/TNFRSF1B is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. TNFR2/CD120b/TNFRSF1B is not a major contributing factor to the genetic risk of type 2 diabetes, its associated peripheral neuropathy and hypertension and related metabolic traits in North Indians. Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B) has been reported to be associated with SLE risk in Japanese populations. TNFR2/CD120b/TNFRSF1B serves as a receptor with high affinity for TNFSF2 and approximately 5-fold lower affinity for homotrimeric TNFSF1. This receptor mediates most of the metabolic effects of TNF-alpha. Isoform 2 blocks TNF-alpha-induced apoptosis, which suggests that it regulates TNF-alpha function by antagonizing its biological activity.

  • Komata T, et al. (1999) Association of tumor necrosis factor receptor 2 (TNFR2) polymorphism with susceptibility to systemic lupus erythematosus. Tissue Antigens. 53(6): 527-33.
  • Tsuchiya N, et al. (2001) Analysis of the association of HLA-DRB1, TNFalpha promoter and TNFR2 (TNFRSF1B) polymorphisms with SLE using transmission disequilibrium test. Genes Immun. 2(6): 317-22.
  • Guo G, et al. (1999) Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy. Am J Physiol. 277(5): 766-72.
  • Size / Price
    Каталог: MG50128-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.