After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TNFRSF13B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_021349.1
Размер кДНК:750bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 13b with N terminal His tag.
Синоним гена:Taci, 1200009E08Rik
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:pCMV3-His-mTNFRSF13B
Участок рестрикции:KpnI + XbaI (6kb + 0.84kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse TNFRSF13B Gene Plasmid Map
Mouse TNFRSF13B natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50130-ACGRBS15400
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50130-ACRRBS15400
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50130-CFRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50130-CHRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50130-CMRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50130-CYRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин клон кДНК в вектор клонированияMG50130-MRBS5130
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50130-NFRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50130-NHRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50130-NMRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50130-NYRBS13340
Мышь TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмидыMG50130-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tumor necrosis factor receptor superfamily, member 13B (TNFRSF13B) also known as Transmembrane activator and CAML interactor (TACI) and CD267 antigen, is a member of the tumor necrosis factor receptor superfamily. TNFRSF13B is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. TACI/TNFRSF13B/CD267 induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand.

Ссылки
  • Salzer U, et al. (2005) Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet. 37(8): 820-8.
  • Salzer U, et al. (2009) Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood. 113(9): 1967-76.
  • Mohammadi J, et al. (2009) Novel mutations in TACI (TNFRSF13B) causing common variable immunodeficiency. J Clin Immunol. 29(6): 777-85.
  • Size / Price
    Каталог: MG50130-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse TNFRSF13B natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».