Быстрый заказ

Text Size:AAA

Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TNFRSF10B Информация о продукте «Клон cDNA»
Размер кДНК:1146bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 10b with C terminal Flag tag.
Синоним гена:MK, DR5, Ly98, KILLER, TRICKB, TRAILR2, TRICK2A, TRICK2B, Tnfrsf10b
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50412-ACGRBS15400
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50412-ACRRBS15400
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50412-CFRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50412-CHRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50412-CMRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50412-CYRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин клон кДНК в вектор клонированияMG50412-GRBS5130
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50412-NFRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50412-NHRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50412-NMRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50412-NYRBS13340
Мышь TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмидыMG50412-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • Size / Price
    Каталог: MG50412-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.