Быстрый заказ

Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь TNFAIP6 Информация о продукте «Клон cDNA»
Размер кДНК:828bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor necrosis factor alpha induced protein 6 with C terminal HA tag.
Синоним гена:Tsg6, TSG-6, Tnfip6
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with TNFAIP6 qPCR primers for gene expression analysis, MP200492 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50498-ACGRBS15400
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50498-ACRRBS15400
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50498-ANGRBS15400
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50498-ANRRBS15400
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50498-CFRBS13340
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50498-CHRBS13340
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50498-CMRBS13340
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50498-CYRBS13340
Мышь TNFAIP6 Джин клон кДНК в вектор клонированияMG50498-MRBS5130
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50498-NFRBS13340
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50498-NHRBS13340
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50498-NMRBS13340
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50498-NYRBS13340
Мышь TNFAIP6 Джин ORF экспрессии кДНК клона плазмидыMG50498-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50498-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.