After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TMEM27 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020626.2
Размер кДНК:669bp
Описание кДНК:Full length Clone DNA of Mus musculus transmembrane protein 27 with N terminal HA tag.
Синоним гена:NX17, NX-17, NX=17, collectrin, 0610008J07Rik, Tmem27
Виды:Mouse
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50547-ACGRBS15400
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50547-ACRRBS15400
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50547-CFRBS13340
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50547-CHRBS13340
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50547-CMRBS13340
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50547-CYRBS13340
Мышь TMEM27 Джин клон кДНК в вектор клонированияMG50547-MRBS5130
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50547-NFRBS13340
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50547-NHRBS13340
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50547-NMRBS13340
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50547-NYRBS13340
Мышь TMEM27 Джин ORF экспрессии кДНК клона плазмидыMG50547-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TMEM27 is a membrane protein. It has been proposed as a beta cell mass biomarker since it is cleaved and shed by pancreatic beta cells. Overexpression of TMEM27 leads to increased thymidine incorporation, whereas silencing of Tmem27 using RNAi results in a reduction of cell replication. Furthermore, transgenic mice with increased expression of Tmem27 in pancreatic beta cells exhibit increased beta cell mass. TMEM27 is also important for trafficking amino acid transporters to the apical brush border of proximal tubules.

Ссылки
  • Pasquali L, et al. (2009) Collectrin gene screening in Turner syndrome patients with kidney malformation. J Genet. 88(1):105-8.
  • Tosetto E, et al. (2009) Locus heterogeneity of Dent's disease: OCRL1 and TMEM27 genes in patients with no CLCN5 mutations. Pediatr Nephrol. 24(10):1967-73.
  • Singer D, et al. (2011) Collectrin and ACE2 in renal and intestinal amino acid transport. Channels (Austin). 5(5):410-23.
  • Size / Price
    Каталог: MG50547-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».