After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TMEM246 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025944.3
Размер кДНК:1212bp
Описание кДНК:Full length Clone DNA of Mus musculus transmembrane protein 246 with N terminal His tag.
Синоним гена:AI835809, 2810432L12Rik, 9330170P15Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52552-ACGRBS15400
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52552-ACRRBS15400
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52552-ANGRBS15400
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52552-ANRRBS15400
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52552-CFRBS13340
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52552-CHRBS13340
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52552-CMRBS13340
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52552-CYRBS13340
Мышь TMEM246 Джин клон кДНК в вектор клонированияMG52552-GRBS5130
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52552-NFRBS13340
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52552-NHRBS13340
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52552-NMRBS13340
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52552-NYRBS13340
Мышь TMEM246 Джин ORF экспрессии кДНК клона плазмидыMG52552-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52552-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».