Быстрый заказ

Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TMEM186 Информация о продукте «Клон cDNA»
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Mus musculus transmembrane protein 186 with C terminal His tag.
Синоним гена:AI648175, AW210586, 2810440M13Rik, 4432406C05Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52286-ACGRBS15400
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52286-ACRRBS15400
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52286-ANGRBS15400
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52286-ANRRBS15400
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52286-CFRBS13340
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52286-CHRBS13340
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52286-CMRBS13340
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52286-CYRBS13340
Мышь TMEM186 Джин клон кДНК в вектор клонированияMG52286-GRBS5130
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52286-NFRBS13340
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52286-NHRBS13340
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52286-NMRBS13340
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52286-NYRBS13340
Мышь TMEM186 Джин ORF экспрессии кДНК клона плазмидыMG52286-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52286-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.