TMEM14C cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

TMEM14C cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
345 bp
Description
Full length Clone DNA of Mouse transmembrane protein 14C with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TMEM14C cDNA ORF Clone, Mouse, C-His tag: Alternative Names

1110021D01Rik cDNA ORF Clone, Mouse; AU020193 cDNA ORF Clone, Mouse; HSPC194 cDNA ORF Clone, Mouse

TMEM14C Background Information

Full Name
transmembrane protein 14C

TMEM14C cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait