Быстрый заказ

Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TMEM14C Информация о продукте «Клон cDNA»
Размер кДНК:345bp
Описание кДНК:Full length Clone DNA of Mus musculus transmembrane protein 14C with C terminal His tag.
Синоним гена:HSPC194; AU020193; 1110021D01Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52274-ACGRBS15400
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52274-ACRRBS15400
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52274-ANGRBS15400
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52274-ANRRBS15400
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52274-CFRBS13340
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52274-CHRBS13340
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52274-CMRBS13340
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52274-CYRBS13340
Mouse TMEM14C Gene cDNA clone plasmidMG52274-GRBS3620
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52274-NFRBS13340
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52274-NHRBS13340
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52274-NMRBS13340
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52274-NYRBS13340
Мышь TMEM14C Джин клон кДНК в вектор клонированияMG52274-URBS5130
Мышь TMEM14C Джин ORF экспрессии кДНК клона плазмидыMG52274-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52274-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.