After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TMEM120B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001039723.2
Размер кДНК:1020bp
Описание кДНК:Full length Clone DNA of Mus musculus transmembrane protein 120B with N terminal His tag.
Синоним гена:Tmem120b
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51961-ACGRBS15400
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51961-ACRRBS15400
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51961-ANGRBS15400
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51961-ANRRBS15400
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51961-CFRBS13340
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51961-CHRBS13340
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51961-CMRBS13340
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51961-CYRBS13340
Мышь TMEM120B Джин клон кДНК в вектор клонированияMG51961-GRBS5130
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51961-NFRBS13340
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51961-NHRBS13340
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51961-NMRBS13340
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51961-NYRBS13340
Мышь TMEM120B Джин ORF экспрессии кДНК клона плазмидыMG51961-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».