TIMP-1 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

TIMP-1 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Mouse tissue inhibitor of metalloproteinase 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TIMP-1 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

Clgi cDNA ORF Clone, Mouse; EPA cDNA ORF Clone, Mouse; Timp cDNA ORF Clone, Mouse; TIMP-1 cDNA ORF Clone, Mouse; TPA-S1 cDNA ORF Clone, Mouse

TIMP-1 Background Information

TIMP metallopeptidase inhibitor 1, also known as TIMP-1/TIMP1, Collagenase inhibitor 16C8 fibroblast Erythroid-potentiating activity, TPA-S1TPA-induced proteinTissue inhibitor of metalloproteinases 1, is a natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. TIMP-1/TIMP1 is found in fetal and adult tissues. Highest levels are found in bone, lung, ovary and uterus. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 mediates erythropoiesis in vitro; but, unlike IL-3, it is species-specific, stimulating the growth and differentiation of only human and murine erythroid progenitors. In addition to its inhibitory role against most of the known MMPs, the protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this protein encoding gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This encoding gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 is Known to act on MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-1, MMP-11, MMP-12, MMP-13 and MMP-16.
Full Name
TIMP metallopeptidase inhibitor 1
References
  • Hornebeck W (2004). Down-regulation of tissue inhibitor of matrix metalloprotease-1 (TIMP-1) in aged human skin contributes to matrix degradation and impaired cell growth and survival.. Pathol. Biol. 51 (10): 569-73.
  • Soini Y, et al. (2001) Expression of MMP2, MMP9, MT1-MMP, TIMP-1, and TIMP2 mRNA in valvular lesions of the heart. J Pathol. 194(2):225-31.
  • Wang X, et al. (1999) Analysis of coding sequences for tissue inhibitor of metalloproteinases 1 (TIMP-1) and 2 (TIMP2) in patients with aneurysms. Matrix Biol. 18(2):121-4.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait