Быстрый заказ

Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь TIMM23 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_016897.3
    Размер кДНК:630bp
    Описание кДНК:Full length Clone DNA of Mus musculus translocase of inner mitochondrial membrane 23.
    Синоним гена:Tim23
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TIMM23 qPCR primers for gene expression analysis, MP201254 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51381-ACGRBS15400
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51381-ACRRBS15400
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51381-CFRBS13340
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51381-CHRBS13340
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51381-CMRBS13340
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51381-CYRBS13340
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51381-NFRBS13340
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51381-NHRBS13340
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51381-NMRBS13340
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51381-NYRBS13340
    Мышь TIMM23 Джин клон кДНК в вектор клонированияMG51381-URBS5130
    Мышь TIMM23 Джин ORF экспрессии кДНК клона плазмидыMG51381-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51381-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».