After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse THY1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009382.3
Размер кДНК:489bp
Описание кДНК:Full length Clone DNA of Mus musculus thymus cell antigen 1, theta with C terminal His tag.
Синоним гена:T25, CD90, Thy-1, Thy1.1, Thy1.2, Thy-1.2, Thy1
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50461-ACGRBS15400
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50461-ACRRBS15400
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50461-CFRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50461-CHRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50461-CMRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50461-CYRBS13340
Мышь CD90/THY-1 Джин клон кДНК в вектор клонированияMG50461-MRBS5130
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50461-NFRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50461-NHRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50461-NMRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50461-NYRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмидыMG50461-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

Ссылки
  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Size / Price
    Каталог: MG50461-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».