Быстрый заказ

Text Size:AAA

Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse THY1 Информация о продукте «Клон cDNA»
Размер кДНК:489bp
Описание кДНК:Full length Clone DNA of Mus musculus thymus cell antigen 1, theta with C terminal His tag.
Синоним гена:T25, CD90, Thy-1, Thy1.1, Thy1.2, Thy-1.2, Thy1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50461-ACGRBS15400
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50461-ACRRBS15400
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50461-CFRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50461-CHRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50461-CMRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50461-CYRBS13340
Мышь CD90/THY-1 Джин клон кДНК в вектор клонированияMG50461-MRBS5130
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50461-NFRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50461-NHRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50461-NMRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50461-NYRBS13340
Мышь CD90/THY-1 Джин ORF экспрессии кДНК клона плазмидыMG50461-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mouse Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Size / Price
    Каталог: MG50461-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.