Быстрый заказ

Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TGTP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001145164.1
Размер кДНК:1248bp
Описание кДНК:Full length Clone DNA of Mus musculus T cell specific GTPase 2.
Синоним гена:OTTMUSG00000005537
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51335-ACGRBS15400
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51335-ACRRBS15400
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51335-ANGRBS15400
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51335-ANRRBS15400
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51335-CFRBS13340
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51335-CHRBS13340
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51335-CMRBS13340
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51335-CYRBS13340
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51335-NFRBS13340
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51335-NHRBS13340
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51335-NMRBS13340
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51335-NYRBS13340
Мышь TGTP2 Джин клон кДНК в вектор клонированияMG51335-URBS5130
Мышь TGTP2 Джин ORF экспрессии кДНК клона плазмидыMG51335-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51335-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».