After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TFRC Информация о продукте «Клон cDNA»
Размер кДНК:2292bp
Описание кДНК:Full length Clone DNA of Mus musculus transferrin receptor with N terminal His tag.
Синоним гена:TR, TFR, p90, CD71, TFR1, Trfr, Mtvr1, Mtvr-1, AI195355, AI426448, AU015758, 2610028K12Rik, E430033M20Rik, Tfrc
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50741-ACGRBS16760
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50741-ACRRBS16760
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50741-ANGRBS16760
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50741-ANRRBS16760
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50741-CFRBS14710
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50741-CHRBS14710
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50741-CMRBS14710
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50741-CYRBS14710
Мышь TFRC/CD71 Джин клон кДНК в вектор клонированияMG50741-GRBS5130
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50741-NFRBS14710
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50741-NHRBS14710
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50741-NMRBS14710
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50741-NYRBS14710
Мышь TFRC/CD71 Джин ORF экспрессии кДНК клона плазмидыMG50741-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mouse transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • Size / Price
    Каталог: MG50741-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.